Friday, May 30, 2008

ID Theory

A major criticism of Intelligent Design Theory (ID) is that it is not science. One prominent Catholic who has been vocal on that account is George Coyne, former Director of the Vatican Observatory. He wrote an article in response to Christoph Cardinal Schönborn, "Finding Design in Nature," New York Times, July 7, 2005. The Cardinal wrote about design and randomness as it relates to science and religion. I'll get to that letter eventually, but I want to make another point here.

In George Coyne, "God's Chance Creation," The Tablet, Aug. 6, 2005, the astronomer says, "It is unfortunate that creationism has come to mean some fundamentalistic, literal, scientific interpretation of Genesis." (I think it's important for Catholics to not alienate fundamentalists, but that is also another subject). The statement highlights the problem of understanding Intelligent Design Theory. It is different from Biblical literalism and fundamentalist doctrine. Most ID advocates believe the Earth is about 4.5 billion years old, in contrast to Young Earth Creationists who think God created the Earth in 6 24-hour days about 10-14 thousand years ago. ID scientists use modern scientific facts to analyze nature. They see the types of things I've been posting on this blog--a phenomenal complexity in living organisms.

Another problem is highlighted in this quote:
Information storage and transmittal is very similar in non-living and living systems. Life began on earth, which formed about 4.5x 1 billion years ago, within about the first 400 million years, a relatively rapid transition to life. In fact, the search for life's origins may be in vain. There may be no clear origin, no clear threshold as seen by science, between the non-living and living.
I'm not sure what kind of information transmittal of non-living systems he means. The planets are made of elements which can combine and transfer energy, presumably in a random way following laws of physics and chemistry. But "random" is not what we see in biological information stored in DNA. If he speaks of digital types of information storage when he talks about the differences between non-living systems and living, such as computer storage and electronic information transmittal, these are based on physical components and laws but are manipulated by humans for their information content and transmission. There may be natural non-living formations of crystals in minerals and we may get amino acids from lightning, but the claim that there is no clear difference between non-living and living is in my opinion a stretch to put it mildly. I hope this difference which so many take lightly, along with the fact that Intelligent Design Theory is intimately connected with actual science, is becoming clear to more and more people.

~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

I'll probably be repetitive on some subjects--please bear with me. Repitition helps you learn, right? But I'll try not to forget what I've written altogether and present something as a brand new subject when I've done it before! I'd like to post 2 entries per week, but I'm not promising anything. My husband has a local history website which he updates once a week. I'm not getting much done with the mystery book I'm working on and need to get that into my schedule. I've enjoyed my blog so far very much. I thought about doing it for a while and am glad I started. Thanks for joining me!

Monday, May 26, 2008

RNA Polymerase




In all organisms, DNA carries the information needed to produce proteins that make the structure and do the work of the cells, and pass along this information to the next generation. In order to produce proteins, the DNA must be copied to RNA which takes the information to other molecules for further processing.

The picture above shows DNA (orange) being copied by a protein called RNA polymerase (pronounced po-LIM-er-ace) which in the picture is blue. The green is then the messenger RNA, so-called because there are several kinds of RNA and this one comes as a template off the DNA and eventually gets to other parts of the cell and is used for other protein production, though it may be modified in the meantime.

The RNA polymerase (blue in picture) is made up of amino acids in specific order. I have listed the amino acid order before. There are a few different parts to RNA polymerases which have different sequences but all have to be capable of folding like the one in the picture so they have function. For the fruit fly, this particular sub-unit is found on the Uniprot site at entry A8JUY3 HERE:

10 20 30 40 50 60
MPKEQFRASA LNKKISHVQF GISGADEIQQ EALVRIISKN LYQAQRQPVP YGVLDRRMGI

70 80 90 100 110 120
STKDAMCETC GQGLNECIGH FGYLDLALPV FHIGHFRSTI NILQMICKVC AHVMLKPEDR

130 140 150 160 170 180
QLYEKKLHNP NFSYLGKKAL HVQMLAKAKK VTKCPHCGSP NGGVKKGPGL LKILHDPYKG

190 200 210 220 230 240
RKMDSLFTSN MNEMLRSTQT NRDLNSTLGN YSTAEELTPL MVLDLFEQIP QRDVALLGMC

250 260 270 280 290 300
SHDAHPKHLI VTRVFVPPAC IRPSVLSEVK AGTTEDDLTM KQSEILLIND VIQRHMATGG

310 320 330 340 350 360
KIELIHEDWD FLQLHVALYF HSEISGIPIN MAPKKTTRGI VQRLKGKQGR FRCNLSGKRV

370 380 390 400 410 420
DFSGRTVISP DPNLMINQVG VPVRVAKILT YPERVNPANI RHMRELVRNG PSMHPGANYV

430 440 450 460 470 480
QQRGSSFKKY LAYGNREKVA QELKCGDVVE RHLRDGDIVL FNRQPSLHKM SIMCHRAKVQ

490 500 510 520 530 540
PQRTFRFNEC ACTPYNADFD GDEMNLHLPQ TEEARAEALI LMGNQSNLVT PKNGEILIAA

550 560 570 580 590 600
TQDFITGGYL LTQKEVFLTK EEAMQLAACF LANEDSTMHI KLPPPALLKP RRLWTGKQMF

610 620 630 640 650 660
SLLMRPNDDS QVRLNMVNKG RNYTRNKDLC SNDSWIHIRN SELMCGVMDK ATMGSGTKQC

670 680 690 700 710 720
IFYLLLRDFG ESHATKAMWR LARNRGFSFG ISDVTPSKKL LQHKELLLNN GYAKCNEYIE

730 740 750 760 770 780
LLKAGTLQCQ PGCTPEETLE SVMLRELSAI REQAAKTCFA ELHPTNSALI MALSGSKGSN

790 800 810 820 830 840
INISQMIACV GQQAISGKRV PNGFENRALP HFERHSAIPA ARGFVQNSFY SGLTPTEFFF

850 860 870 880 890 900
HTMAGREGLV DTAVKTAETG YLQRRLVKCL EDLVVHYDGT VRNAVNEMVD TIYGGDGLDP

910 920 930 940 950 960
VSMETRNKPV DLVHQYDNLR AQHPQGKDRP LNAEEMSEAL ETLLRTPEFA EARDDFKLDV

970 980 990 1000 1010 1020
RNHINTVSKR IGQLQKRYEK CIDLCHQIEC LTTEQLLQFV RRINDRYNRA VTEPGTAVGA

1030 1040 1050 1060 1070 1080
IAAQSIGEPG TQMTLKTFHF AGVASMNITQ GVPRIVEIIN ATKTISTPII TAELENCHSM

1090 1100 1110 1120 1130 1140
EFARQVKARI EKTTLAELSS YVEVVCGPYS CYLAIGVDMA RIKLLGLHID LDTIVFSILK

1150 1160 1170 1180 1190 1200
SRMRVKPTQV EVVASQSRIV VRVEATRTST INAELARLAL SLQNVVVAGL PNINRAVIAV

1210 1220 1230 1240 1250 1260
DDARQPPTYK LCIEGYGLRD VIATYGVVGK RTRSNNICEI YQTLGIEAAR TIIMSEITEV

1270 1280 1290 1300 1310 1320
MEGHGMSVDW RHIMLLASQM TARGEVLGIT RHGLAKMRES VFNLASFEKT ADHLFDAAYY

1330 1340 1350 1360 1370
GQTDAINGVS ERIILGMPAC IGTGIFKLLQ QHEDKQVPPI EPTICSSLNL LPSKTT


And here on the right is one of the amino acids of the protein chain, L-Aspartic Acid. For every D abbreviation in the list above, this would be inserted. The letters stand for atoms. H=hydrogen, O=Oxygen, C=Carbon (understood to be at the corners of the connected lines) and N=nitrogen. The others are in the Creation Wiki link to amino acids HERE.

The picture of RNA polymerase at the top is not necessarily based exactly on the fuit fly, but the function is general throughout biological life. The 20 amino acids that are found in living cells make different kinds of chemical bonds. One of the connections of the bonds has to do with the spiral shape of the protein. Others affect the "folding" of the entire protein which gives it an over-all shape. So as said earlier, these amino acids have to connect in a certain way and be specific distances apart from each other to give the proteins the shape that gives them the ability to function, among other considerations. In fact, it's been estimated only 1 in 10^63 to about 1 in 10^77 combinations of amino acids will give a shape that works. 10^77 is a 1 with 77 zeroes after it, 10^63 a 1 with 63 zeroes after it.

You may wonder why I keep copying the codes to different genes and proteins. I probably won't do much more of it, but I want to show how complex these microscopic yet critical structures of biology are. It helps you realize why the proportion of amino acid combinations for functional proteins is so small.

I believe that God created this world. My husband and I will be attending a Memorial Day service at our church's cemetery today in conjunction with the other Catholic churches of our area. Though I would believe in God wherever I lived, I am grateful for the sacrifices of the men and women of the armed forces that allow me to freely express my belief as I do.

Thursday, May 22, 2008

FF 7, Dicer


The embryo of the fruit fly has DNA which detects proteins that are diffusing toward it. These proteins can attach to the DNA to turn on, or promote the genes to produce their own proteins which will become part of the adult fly. Therefore, the genes can be in the 'on' or 'off' state. John Lennox in his book God's Undertaker: Has Science Buried God (Update: Lion Hudson, New Edition 2009) puts the difference between a gene being on and off in mathematical terms. For every gene that has receptors for either producing or not producing, this is a "switch" at any given time. Just the on and off, without considering grades of difference as there are in the embryo, puts each of those genes to the base 2 and the number of switches as its exponent. Considering there are around 13,000 genes in the fruit fly, this gets to be a big number. The number 2^13,000 can be converted to base 10 to about 10^3900 (see Exponent link on right for explanation of exponents, ^) which gives you the number of different states the total set of genes could be in at any one time.

So, when you think about how a fruit fly could have evolved from a single cell, you have to think about how all these genes with hundreds of base pairs each could get to produce proteins which in turn could turn the genes back on at just the right time to produce not only a living cell that it came from but other manifestations that would give heads and lungs and blood cells and vessels and muscles and the multitude of systems we need.

That brings us to DICER (image in this post with more information HERE ). Dicer is found in humans, fruit flies, and single-celled animals. Proteins are often used to help reactions of other molecules in the cell. These are called enzymes.

Dicer does an amazing thing. RNA, as we've seen, is copied from the DNA of cells in the process of protein production. Dicer is required for a metabolic pathway that cuts up RNA so it can repress or turn off gene expression (in other words, stops the gene from producing the RNA that will help produce a particular protein). Genes sometimes need to produce proteins and sometimes need to not produce them because there are already enough in the body. This is a feedback mechanism.

Now, in the fruit fly embryo which we've just discussed, we had proteins which turned on gene expression. The DNA had sets of genes which detected molecules of protein that diffused to the embryo's DNA. When the gene and the protein combined (because they were a chemical "fit"), the gene started making proteins for the particular part of the body that the fruit fly would develop (head, thorax, tail).

This regulation is another level of complexity. You not only have the genes with their specific order, but then they work in concert with other genes to get the right things done in the body. Considering there are thousands of genes and up to a million different types of protein products (humans), that's a super-switching apparatus.

Remember, William Dembski, in The Design Inference, put the maximum number of events in the entire universe, even if it started 14 billion years ago, at 10^150. This number comes from the estimated number of particles in the universe (10^80) times the maximum number of reactions per second (10^45) times the number of seconds in the universe (10^25--which even includes future time). At base 2, your bound for the entire number of events is about 2^500. To be fair, there could be other proteins which do the same job and could be substituted for the ones used. But there have been experiments that show that only one protein in 10^77 is usable (see Stephen Meyer book, Signature in the Cell). That is because the amino acids have to line up right to get the right shape for the protein to work. As you see in Dicer, it has a very unique shape and that is because cross-bridges and other types of chemical bonds in the amino acids can hold it in the shape it has. Once you reach 2^500, you have used up all events of the universe to try to get it right.

Eventually, John Lennox stopped counting because the probabilities for these organisms to happen by chance became too great. Though there will probably be endless efforts by some to prove materialistic, naturalistic evolution is right, it is proper when one beholds these wonders to say, "Praise the Lord!"

Monday, May 19, 2008

FF 6, Bicoid

The protein bicoid is used by the DNA in a fruit fly embryo to determine the proteins that will be made by this same DNA. The concentration of bicoid that is diffusing from front to back of the embryo will be detected by the various genes that make up DNA in nuclei (clumps of DNA) that line the walls from the front to back of the embryo. The link I have given in the previous 2 posts for the fruit fly embryo picture is HERE. I will show the bicoid gene below.

Before I go further, though, I'd like to give you a link to a website that has more reporting on new research that points toward design. It is Evolution News, the newsletter of Discovery Institute (one of the main "think tanks" for Intelligent Design).

The following ATCG letters are the gene code for bicoid in the fruit fly found on the website FlyBase. (Update in 2019: I had a link from FlyBase at the time of the post but it no longer goes there. I do have a link to the code in another database called KEGG. It is HERE.)

ATCTCTTCGCTCATCCCTAAATAACGGCACTCTGCAGATGCGAAGCAGTG
GATCGCAAAAACGCAAAATGTGGGCGAAATAAGTTCGCGAGCGTCTCGAA
AGTAACCGGTTACTGAAAATACAAGAAAGTTTCCACACTCCTTTGCCATT
TTTCCGCGCGGCGCTTGGAAATTCGTAAAGATAACGCGGCGGAGTGTTTG
GGGAAAATGGCGCAACCGCCGCCAGATCAAAACTTTTACCATCATCCGCT
GCCCCACACGCACACACATCCGCATCCGCACTCCCATCCGCATCCGCACT
CGCATCCGCACCCACATCACCAACATCCGCAGCTTCAGTTGCCGCCACAA
TTCCGAAATCCCTTCGATTTGGTGAGTTCCCATCGCAGCAGAGAAGGGCT
CTTGTCCCAGGAAAGCTACAGTACAGATTCCCTATGGTGAACAAACAACC
AGTGCGATCACTGATGACCATAAACATTTATTGAGCCGCAGCAAATGTGT
TTCTAGAACATAGGGCGAAATCTTCTATTATCTTGTTTGTGACTTTTAAA
GTATCGTAGCAGAATCTAAAAACCAATTGATATTATTAATCGTTACAGTT
AGTATAGTATATAATTGTATATGAATTGTGGGGCATCATGTTATTAGTGA
TTTGCCGAAATGTTCTAAAAGGTGTTTCATTGAAATGGACGAATGTTAAA
CCTGTTGCACTCACACCGACAATCAGTAATGTCTATTTTTCAAAAGCCAC
ATCTATGGCCACTGGGTATACATTATTGACTTTATACACTTCATACAACA
TATTTTCTAAAACAAGCATTGTTGTCCTGCATGATGATTAGTGAAAGTAA
TATTGCAAGATTCGGTCCCCGAAGCGAATCGTCCTTTCACGTTTTTATAT
AAAGACAGTGTACCCCTTGATTCTTTGAAGCTTTTCGATGAGCGAACGGG
AGCGATAAACTACAACTACATACGTCCGTATCTGCCCAACCAGATGCCCA
AGCCAGGTGAGCTCAAAGCCAACAAAGTCAGCCATCGTCTTATCAGATGT
CTTTCCCTCAGAGGAGCTGCCCGACTCTCTGGTGATGCGGCGACCACGTC
GCACCCGCACCACTTTTACCAGCTCTCAAATAGCAGAGCTGGAGCAGCAC
TTTCTGCAGGGACGATACCTCACAGCCCCCCGACTTGCGGATCTGTCAGC
GAAACTAGCCCTGGGCACAGCCCAGGTGAAGATATGGTTTAAGAACCGTC
GGCGTCGTCACAAGATCCAATCGGATCAGCACAAGGACCAGTCCTACGAG
GGGATGCCTCTCTCGCCGGGTATGAAACAGAGCGATGGCGATCCCCCCAG
CTTGCAGACTCTTAGCTTGGGTGGAGGAGCCACGCCCAACGCTTTGACTC
CGTCACCCACGCCCTCAACGCCCACTGCACACATGACGGAGCACTACAGC
GAGTCATTCAACGCCTACTACAACTACAATGGAGGCCACAATCACGCCCA
GGCCAATCGTCACATGCACATGCAGTATCCTTCCGGAGGGGGGCCAGGAC
CTGGGTCGACCAATGTCAATGGCGGCCAGTTCTTCCAGCAGCAGCAGGTC
CATAATCACCAGCAGCAACTGCACCACCAGGGCAACCACGTGCCGCACCA
GATGCAGCAGCAGCAACAGCAGGCTCAGCAGCAGCAATACCATCACTTTG
ACTTCCAGCAAAAGCAAGCCAGCGCCTGTCGCGTCCTGGTCAAGGACGAA
CCGGAGGCCGACTACAACTTCAACAGCTCGTACTACATGCGATCGGGAAT
GTCTGGCGCCACTGCATCGGCATCCGCTGTGGCCCGAGGCGCTGCCTCGC
CGGGCTCCGAGGTCTACGAGCCATTAACACCCAAGAATGACGAAAGTCCG
AGTCTGTGTGGCATCGGCATCGGCGGACCTTGCGCCATCGCCGTTGGCGA
GACGGAGGCGGCCGACGACATGGACGACGGAACGAGCAAGAAGACGACGC
TACAGGTCAGGCATGAGTCCACAACCTTTTTTGATCTCTTGATTCTGAGT
GTGGCGTTTATAAATTGAAGCTTTAAGCTTTGTAACTTTCAAACTGTCTG
GTTTGAGATGTTATTCTGAAAGTACTTCTATTTCCGATCGATGAGATTTG
GGAGTTCTCCAATATTTAACATTTAACTTATTAAGTTTTTGTTTTCTAAA
TTAGACATGGCATTTCTGAAAGGGAAGTACAAGTGTTAAAGATGTATTTT
AATATAGAATTTGTATCAAAGGTTAAGATTTCAACCGTTTGAAAGCCCTT
AGTTTTCAGGGTTTTTTACTTTTTTATTCATGTAATCACTCTTAATACAC
TGCAAGTTAAAATAGCATTTCTTTGACCAGAAAAATAAGATCTATGCATT
TTAAAAGTGAAAACAGACTCATATGCTGATGAACATTTTTAGCTATAAAT
TGTAACAATAATTTAGCAATTTCAATCGAATTTATTTATGTTCTAAATGC
GTTCGCTCTCTCCCTAGATCTTGGAGCCTTTGAAGGGTCTGGACAAGAGC
TGCGACGATGGCAGTAGCGACGACATGAGCACCGGAATAAGAGCCTTAGC
AGGAACCGGAAATCGTGGAGCGGCATTTGCCAAATTTGGCAAGCCTTCGC
CCCCACAAGGCCCTCAGCCGCCCCTCGGAATGGGGGGCGTGGCCATGGGC
GAATCGAACCAATATCAATGCACGATGGATACGATAATGCAAGCGTATAA
TCCCCATCGGAACGCCGCGGGCAACTCGCAGTTTGCCTACTGCTTCAATT
AGCCTGGATGAGAGGCGTGTTAGAGAGTTTCATTAGCTTTAGGTTAACCA
CTGTTGTTCCTGATTGTACAAATACCAAGTGATTGTAGATATCTACGCGT
AGAAAGTTAGGTCTAGTCCTAAGATCCGTGTAAATGGTTCCCAGGGAAGT
TTTATGTACTAGCCTAGTCAGCAGGCCGCACGGATTCCAGTGCATATCTT
AGTGATACTCCAGTTAACTCTATACTTTCCCTGCAATACGCTATTCGCCT
TAGATGTATCTGGGTGGCTGCTCCACTAAAGCCCGGGAATATGCAACCAG
TTACATTTGAGGCCATTTGGGCTTAAGCGTATTCCATGGAAAGTTATCGT
CCCACATTTCGGAAATTATATTCCGAGCCAGCAAGAAAATCTTCTCTGTT
ACAATTTGACATAGCTAAAAACTGTACTAATCAAAATGAAAAATGTTTCT
CTTGGGCGTAATCTCATACAATGATTACCCTTAAAGATCGAACATTTAAA
CAATAATATTTGATATGATATTTTCAATTTCTATGCTATGCCAAAGTGTC
TGACATAATCAAACATTTGCGCATTCTTTGACCAAGAATAGTCAGCAAAT
TGTATTTTCAATCAATGCAGACCATTTGTTTCAGATTCGGAGATTTTTTG
CTGCCAAACGGAATAACTATCATAGCTCACATTCTATTTACATCACTAAG
AAGAGCATTGCAATCTGTTAGGCCTCAAGTTTAATTTTAAAATGCTGCAC
CTTTGATGTTGTCTCTTTAAGCTTTGTATTTTTAATTACGAAAATATATA
AGAACTACTCTACTCGGGT


Each of these letter stands for what is called a nucleotide, which is made up of atoms. A picture of one of them, thymine (T) is here:

The atoms are C for carbon, O for oxygen, H for hydrogen and N for nitrogen. You would have to substitute one of these nucleotides for each of the letters of bicoid gene that is above to give one strand of the DNA. This alone does not present the whole picture of complexity, because the DNA of the embryo has parts which detect the concentrations of bicoid that the mother's cells stimulate into production inside the new embryo which in turn set the embryo bicoid gene into motion. Some embryo DNA genes are sensitive to high concentrations of bicoid, some are sensitive to less concentrations.

The fruit fly has 180 million pairs of nucleotides. Half of a nucleotide pair is shown in the picture. The organism uses these nucleotides as a blueprint to make all the body parts like head, eyes, legs, thorax, and systems of its body, including muscle, nerve, breathing, circulatory, hormonal, digestive and reproductive systems.

The human being has 3.6 billion of these nucleotide pairs in one set of Chromosomes. John Lennox goes through some of the probabilities for the atoms and molecules to come to these structures by chance in his book, God's Undertaker: Has Science Buried God? (Oxford: Lion, 2007). He teaches math at Oxford University. It comes down to being impossible. He suggests we look at life like we have come to understand perpetual motion machines--that it just doesn't happen by the laws of nature.
 
Combine that with the findings of the article, Koonin and Wolf, "Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world," Nucleic Acids Research 36, 21 (1 Dec. 2008): 6688-6719l. Eugene Koonin and Yuri Wolf are researchers at the National Center for Biotechnology Information (NCBI). The proteins of bacteria are unlike those of other animals and plants. There is not a smooth line of evolution and there is not enough time for all these proteins to have come into working order even in billions of years. Yes, there may be small changes to bring about some variety in species. But for the most part, something else must be involved.

I am not an expert at reading gene graphs and knowing all the in's and out's of genes. I'm not an expert mathematician or chemist or physicist. Which one person is all of these put together? I know enough to know organisms did not come about by chance. That is because it is obvious. To paraphrase Paul in Romans 1 of the Bible, we can see the magnificent divine nature of God from what is made. These days, because of all that is known, one can look more closely and dig deeper, but the phenomenal majesty of the world still is there to see.

Thursday, May 15, 2008

FF 5, Embryo 2

The concentration of molecules in the fruit fly embryo determines the "switch" of the DNA to produce specific proteins at specific places that will become the adult parts of the body. There are 4 major molecules from the mother which start the process. The book Developmental Biology, by Scott Gilbert (Sinaur, 6th ed.), describes it in Chapter 9, Sec. 2. (The site only allows searches for the book, but you can enter the term "anterior-posterior polarity" to get where you want.) These molecules in turn produce four proteins which continue the process. The molecules of RNA start from the mother cells in the front of the embryo and diffuse toward the back. The diffusion rate of the molecules is critical to the development of the embryo. The DNA of the new embryo can discriminate the concentration of the molecules of protein made from these mother RNA molecules. It does this by the code in the DNA in sets of genes that detect strong and weaker concentrations. A link to the fruit fly embryo picture HERE is from the book mentioned above.

The bicoid gene in the fruit fly is involved in the development of the embryo. The sequencing of bicoid has been done and I obtained it on the FlyBase website as well as the graph below:



This graph tells where the gene is on the chromosome. The DNA lines up on separate strands in the organism, and the fruit fly has 4 pairs of these, while humans have 23 pairs. In the next entry I will show the sequence of the gene.

2019 Update: I found the graph at the time of my post, but the link and visuals are a little different. However, you can get to the newer one HERE.

Monday, May 12, 2008

Fruit Fly 4, Embryo

The fertilized egg of a fruit fly has a set of cells from the mother. Those cells produce molecules into the egg itself and work to make the beginning of the new larva. There is a wonderful picture which of what goes on from a book on the NCBI website called "Developmental Biology" by Scott Gilbert, published by Sinaur (6th ed.). The link for the fruit fly embryo picture is HERE .

It is a remarkable process to say the least. The female cells which come along with the embryo are called "nurse cells." They therefore have their own production of RNA available for the process of protein production in the embryo. The embryo has to start differentiating so it will eventually produce the anterior (head), middle (thorax and abdomen) and posterior (tail end) of the organism.

One of the startling aspects of this process is that the diffusion of these molecules is critical in how the embryo responds, so that concentrations of mRNA and proteins at particular places within the egg are important in how the animal develops. The genes are sensitive to the concentration and type of proteins within the embryo. A higher concentration produces the head and a lower one produces the thorax and so on. There are also other proteins acting together to form different concentrations of each in different areas. These are all proteins which must be co-ordinated in the embryo and is true for all animals which have front and back, which means it would have all had to be coordinated from the first worm or other such organism.

The number of molecules made from those "nurse" mother cells is important. Research by Gregor, Tank, Wieschaus and Bialek, "Probing the Limits to Positional Information," Cell (Elsevier, 2007) has shown that it is not just a matter of the cells activating from a bunch of molecules being thrown at them. They can tell the difference between large and small quantities in the range of about 70 molecules.

Friday, May 9, 2008

Fruit Fly 3




This picture is from the FlyBase website, where you can see more pictures and the citations for the artists. FlyBase is a collaboration of Harvard University, Indiana University, University of New Mexico, and the University of Cambridge UK funded by the National Human Genome Research Institute (NHGRI).
Flybase Citation: Thurmond J, Goodman JL, Strelets VB, Attrill H, Gramates LS, Marygold SJ, Matthews BB, Millburn G, Antonazzo G, Trovisco V, Kaufman TC, Calvi BR and the FlyBase Consortium. (2019) "FlyBase 2.0: the next generation," Nucleic Acids Res 47(D1) D759-D765.
The picture gives you an idea of the life cycle of the fruit fly. The adult lays eggs (gametes), an egg becomes an embryo and develops into the larva. The larva has cells which eventually become the forms of the adult. The pupa is covered by a shell and the adult eventually emerges (metamorphosis) to complete the cycle. A cycle can happen in as little as a week.

Scientists are finding that many organisms share the same types of genes in the developmental process. This is a tantalizing discovery for them, since it makes it seem like there are enough similarities to assume that nature alone has the ability to bring the changes about. But, the process has great barriers to totally natural evolution. Author Stephen Meyer of the Discovery Institute wrote an important and controversial article in Proceedings of the Biological Society of Washington, 117(2):213-239, 2004 called, "The origin of biological information and the higher taxonomic categories." It is the article featured in the movie Expelled that gave the scientific community shudders because it mentioned "Intelligent Design" in a peer-reviewed publication. It points out the many super-structures which have to be dwelling within the organism simply to bring about its existence as we know it.

Monday, May 5, 2008

Pro- and Eukaryotes

There's probably not a perfect way to arrange information on a blog, just like this is not the most organized way to teach biology. But I'm hoping what I try to present resonates with some of you. I don't see this material in secular media or even from teaching institutions shown in a way that gives persons unbiased explanations of the complexity of biology to evaluate for themselves. I don't search the Internet that closely--and perhaps it's out there somewhere. But most of what I see are either arguments from the philosophical point of view, or science presented (as from educational institutions) in "evolution language," which assumes evolution whether it is proven or not. Words like "conserved" describe genes in a way that compares organisms while implying they are evolved one from another and their genes are similar because of that. Therefore the jargon is charged.

I'm not going to keep from a little philosophy of my own, (opinion is the better word), but I want to add the science and math that go with the ideas. That keeps the arguments more focused, I think. And it is possible for anyone to understand. Creation biology is a reasonable evaluation of experimental evidence .

An important author of genetic biology is Eugene Koonin. Dr. Koonin has written many articles from his position at the National Center for Biotechnology Information (NCBI). One of these, along with two other authors (Aravind and Kondrshov), is from the journal Cell, 101 (6), 573-576, June 9, 2000. The article, "The Impact of Comparative Genomics on Our Understanding of Evolution," is about comparing genes of different kinds of orgnisms and is very important. The public had been told by evolutionists (in general) that multi-celled animals had evolved from single-celled animals. Two main types of cells are called prokaryotic (one-celled bacteria are like this) and eukaryotic (cells which make up plants and animals with multiple cells). The NCBI picture shows the two kinds. See "Cell" in Wikipedia HERE for further information.



The article shows that that this assumption about evolution was wrong. Dr. Koonin and the rest evaluated findings from complete sequencing of genes of bacteria, archaea (other single-celled organisms) and yeast and discuss them in this article. They compared the proteins to see how closely related they were on the microscopic level. They found there were great differences--too great to have easily evolved one from another. The question eventually relates to how the gene affects the way the animal or plant turns out. Dr. Koonin had this to say near the end of the article:
More generally, what we realize with due humility from our first forays into complete-genome-scale comparative genomics, is that we do not truly understand the connection between the genome and the phenotype of an organism.
The phenotype is the outcome, or form, of the animal. I'm not saying it is Eugene Koonin himself who told everyone that eukaryotes evolved from prokaryotes, but scientists in general. But through the comparison of whole genomes, not even possible before 1995, his group shows that this particular evolutionary assumption is wrong. I admire Dr. Koonin for saying what he did.

Saturday, May 3, 2008

Totally Natural Evolution (or not)

I think there is a need for a distinction between totally materialistic, naturalistic evolution and supernatural Creation at any level. The phrase "Totally Natural Evolution" is descriptive so I will use it in my blog. Since this term is a little long, I may use the nickname of "total-natural evolution" once in a while.

In articles and debates about evolution, there is a difference between micro-evolution and macro-evolution. Micro-evolution means that there can be small changes in the genes which occur randomly and lead to small changes in species, even to the point of causing a new species, genus, and perhaps family. Macro-evolution is the theory that there are changes, presumably quite large, that are needed for major changes in animals at a higher level (it goes up by order, class, phylum and kingdom).

Beyond total-natural evolution, we still need to distinguish an evolution that may happen if God intervenes at various levels.

For one thing, we can sort out those who do not accept the process of evolution at all from those who think evolution may have happened but not by chance. One can say, as I think most Intelligent Design advocates do, that micro-evolution can be totally natural evolution, but macro-evolution is not total-natural evolution, or at least up to now has not been proven to be so. Then there are those who believe God created man, the kinds of animals and plants from the start and no evolution was necessary. Perhaps they see some "simple" changes, such as the cat "kind" developing into tigers, lions and the like. These people believe in "Special Creationism" where God has created original beings in a direct supernatural way.

This all may sound confusing, but so do a lot of terms until we get used to them. The term "totally natural evolution" is meant to accompany the meaning of "random" as understood by laypersons as "happening by chance." The "random" and "chance" are understood as operating completely by the laws of physical and chemical nature as it is understood now and without supernatural intervention. I have noticed the meaning of the term "random" changes depending on who uses it: physicists, chemists, geneticists, theologians, philosophers. We need a common understanding of these words so everyone can communicate as clearly as possible about the complex questions of how biological life came to be.

Though total-natural evolutionists say evolution is in part by selection of the fittest, implying that selection eliminates chance, the selection depends on chance changes of the gene from mutation and other supposedly random mechanisms. They cannot escape from the premise that their type of evolution is completely based on chance.

Thursday, May 1, 2008

God of Gaps

At this time, science can not tell us the whole story of how life got started and why it is the way it is. Scientists have done great work and it is OK for them to look forward, but they must skillfully distinguish the difference between known and unknown. For one, a person must keep up with the research literature, not an easy task. Unfortunately, some persons, whether scientists, teachers, administrators or others, present the unproven as fact. In many scientific articles I've read, the processes under study are not fully understood, even after the particular experiment has taken place. Many times the new discoveries lead to more questions.

If a person does not accept that evolution will inevitably be proven, they are accused of the "God of the Gaps" mistake. If a believer says God made life (or did anything in the physical realm), they are thought to be unable to imagine that science will prevail and are using only what will turn out to be a substitute until the real reason is scientifically proven. An example often used is that of Isaac Newton, who described gravity and the motion of planets, but still thought God had to correct the orbits every so often. A later astronomer, Laplace, proved the orbits were stable on their own and famously said that he did not need God in his hypothesis.

What is not often told, though, is that Laplace was a determinist who thought that particle movements could be exactly measured and predicted if enough information was given. Laplace was proven wrong by Heisenberg's Uncertainty Principle of Quantum Mechanics, wherein the exact position and momentum of a particle cannot be measured. And, further knowledge of the universe has shown physical parameters with supremely fine-tuning. Physicists in the 1960's noticed that the laws of the universe are surprisingly fit for existence of biological life. This "Anthropic Principle" brings full-circle our appreciation of God's striking design, not only for planets but for people.

And let's remember, Isaac Newton is still considered one of the greatest scientists in history.

~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

2019 Note: I have finally had some time to look at my blog from the start and make some changes. I hope I can cover it all to current posts so it will be as user-friendly as possible. Thanks for visiting!