Pseudogenes

Evolutionists have used what are called “pseudogenes” as proof of evolution. The pseudogenes are supposed to be broken genes that appear in multiple species that are alleged to have evolved from their ancestors. Many resemble functional genes as if there were random reproduction of the working genes and then decline of the original or duplicate due to generations of mutation and non-use. If the extra genes are broken, goes the thinking, why would they exist in various species unless they were passed along the evolutionary tree?

Fortunately, there are scientists out there who are actually studying biology. The pseudogenes are turning out to have very important functions, often concerning gene regulation. One report is by Cheetham, Faulkner, and Dinger, “Overcoming challenges and dogmas to understand the functions of pseudogenes,” Nature Reviews Genetics 21 (Dec. 17, 2019):191–201. Their article Abstract says volumes:

Pseudogenes are defined as regions of the genome that contain defective copies of genes. They exist across almost all forms of life, and in mammalian genomes are annotated in similar numbers to recognized protein-coding genes. Although often presumed to lack function, growing numbers of pseudogenes are being found to play important biological roles. In consideration of their evolutionary origins and inherent limitations in genome annotation practices, we posit that pseudogenes have been classified on a scientifically unsubstantiated basis. We reflect that a broad misunderstanding of pseudogenes, perpetuated in part by the pejorative inference of the ‘pseudogene’ label, has led to their frequent dismissal from functional assessment and exclusion from genomic analyses. With the advent of technologies that simplify the study of pseudogenes, we propose that an objective reassessment of these genomic elements will reveal valuable insights into genome function and evolution.

There is increasing realization that there are reasons that some genes resemble each other. Ironically, these particular authors are still thinking in the evolutionary mode. Don’t they realize the “pejorative inference of the ‘pseudogene’ label” of which they speak comes 100% from evolutionists? But what at the end they say is true. Their reassessments may give them the ultimate insight: that evolution is very minimal in explaining the diversity and wonder of life.

A major study called ENCODE,  reported by the ENCODE Project Consortium, "An integrated encyclopedia of DNA elements in the human genome,"  Nature 489 (Sept. 5, 2012): 57-74, showed that much more of the DNA in our cells is being actively used than researchers ever expected. One of these scientists is Dr. Francis Collins, director of the National Institutes of Health in Bethesda, Maryland. Before, they had called most of the DNA “junk” which they assumed was from evolutionary mutations. Dr. Collins admitted he was wrong in using the term “junk” and said he would no longer refer to DNA in that way.

Now pseudogenes, which the prominent evolutionists have used as one of their prime examples as worthless, is turning out as valuable genetic material that is currently undergoing much biomedical research which may lead to cures in cancer and other diseases.

Yes, genes mutate. I’m a doctor of veterinary medicine, I know about that. But I also know that the numbers of mutation and the precision of genetics don’t add up. 

When are people going to get over themselves and start thinking outside the box? When can we end the “Galileo Complex,” as Logan Gage, PhD, Chair of the Philosophy Dept. at Franciscan University of Steubenville, calls the extreme reluctance of Catholics to allow that the Lord may have touched His own Creation along the way?

Those who call Creationists "science deniers" often do not know the science themselves. They rely on the evolutionist leaders who, as we are discovering, hold back progress more than advance it.

It is obvious that humans are intelligent creatures who want to discover the workings of the universe, both for curiosity’s sake and to protect ourselves from harm. But we are not to be rigid, either. It takes more intelligence to reach beyond black and white, not less. It is way beyond time to do so.

Orphan Genes

Scientists started comparing whole genome sequences of various species in the 1990’s. Genes that are only found in one or very closely related species are called unique, de novo, ORFan or orphan genes. The amazing thing is that the more they compare species, the more unique genes they find. These genes make up about 10-20% of each organism’s whole set, percentages given by Dr. Ann Gauger, "Orphan Genes: A Guide for the Perplexed," Evolution News, July 30, 2013. I have seen research even in the 30% range. These unique genes are so different from each other that the chance they could have come from an evolutionary sequence is vanishingly small. This is, for one reason, because there could have been no more than 10^50 organisms on Earth so far even if the Earth is very old. The unique genes are statistically so far apart that even this many organisms are not enough to sort through the various possibilities.  (And only one in about 10^70 proteins is functional. So the sorting of proteins for functional ones makes evolution by chance look pretty much impossible.) In contrast, if all genes (and corresponding proteins) were closely related and in obvious sequence in species, Darwin would have been proven right.

Eugene Koonin is Senior Investigator of comparative genomics at National Center for Biotechnology Information (NCBI, a division of NIH) and has written many articles. So he is on the front lines of comparative genomics. He and Yuri Wolf wrote an article in 2008: Koonin and Wolf,  "Genomics of bacteria and archaea: emerging dynamic view of the prokaryotic world," Nucleic Acids Research 36, 21 (Dec. 1 2008): 6688-6719. They found there were some proteins common to many species of bacteria and archaea (one-celled organisms different from bacteria). But what surprised them was the vast amount of variety between species and the unique genes. Koonin has become part of a movement to find other explanations for evolution instead of neo-Darwinism called the Third Way of Evolution. The "evolution" part is because Koonin is committed to evolution although his move shows that he believes neo-Darwinian evolution is falsified. But these findings of comparative genomics also support direct creation of species.

Another article by J. Muller, et al., "eggNOG v2.0," Nucleic Acids Research, Database Issue 38 (Jan. 2010): D190-D195, compares various species. In the diagram there are species names in the middle with radiating lines that go out to colors of the graph. The green and orange represent genes which are related, but the outer gray areas are orphan genes which do not match other species (much easier to see in the full article at the title link).

A more recent article by Jorge Ruiz-Orera, et al., "Origins of de novo genes in human and chimpanzee," PLOS Genetics, Dec. 1, 2015, has reinforced these findings. The researcher and his group were looking for unique human and chimpanzee genes and found them. Their author summary starts:

For the past 20 years scientists have puzzled over a strange-yet-ubiquitous genomic phenomenon; in every genome there are sets of genes which are unique to that particular species i.e. lacking homologues in any other species.

Homologues are related genes. As stated above, these unique genes cannot be explained by the supposed machines of evolution: mutation and selection. The complete published paper can be found at the title link.

On a related subject, a problem in the past was that in comparing genes, scientists used genes they already had to see if they were in the other organisms. This left sequences that did not match out of the loop of potential genes. However, they have begun to use other criteria, such as start and stop sequences, to now identify more non-matching areas that look like genes. This is promising to show even more unique genes.

Bilingual DNA

The University of Washington's Dr. John Stamatoyannopoulos has been a leader in the ENCODE Research, which is an extension of the Human Genome Project.  They continue to study human genes and DNA, the molecule on which the genes reside. The DNA contains coding and is copied in order that the proteins that do the work of our cells are produced.  But it takes a lot of inner cell regulation to get things just right.  Now that they know the genes, the researchers are trying to understand the regulation.  They are making surprising discoveries, reported by Stephanie Seiler, "Sceintists discover double meaning in genetic code," UW News, Dec. 12, 2013: 

Scientists have discovered a second code hiding within DNA. This second code contains information that changes how scientists read the instructions contained in DNA and interpret mutations to make sense of health and disease.

She goes on to say:

Since the genetic code was deciphered in the 1960s, scientists have assumed that it was used exclusively to write information about proteins. UW scientists were stunned to discover that genomes use the genetic code to write two separate languages. One describes how proteins are made, and the other instructs the cell on how genes are controlled. One language is written on top of the other, which is why the second language remained hidden for so long.

The paper is Stergachis et al., "Exonic transcription factor binding directs codon choice and affects protein evolution," Science 342, 6164 (Dec. 13, 2013): 1367-1372.  It is open access now at NCBI PMC, but it is written for those who understand the jargon. I will try to explain it to some degree and Casey Luskin at Evolution News explains aspects of it which you can read HERE.

DNA contains 4 different types of “bases” which are molecules that form a code (see first image, Double Helix, from NHGRI Talking Glossary of Genetic Terms). Two bases form each "step" of the DNA "ladder." Then groups of three bases, called “codons,” line up in precise order to give instruction to other mechanisms for the production of proteins.  We think of the codons as a language because their sequence affects the outcome beyond strictly chemical interactions.

The bases have an “end” for connecting to the side of the ladder and an “end” for producing the code. When DNA is copied, the middle splits open the long way and another molecule comes along to copy it.  This is done in the middle of the cell called the “nucleus.” Then the copy leaves the nucleus and is processed in the outer cell compartment to make the proteins. The protein production takes several intermediate steps, and the codon code is read to put together the protein.

DNA codes for proteins that carry on the functions of biological life.  Among these proteins are “transcription factors” (TF) that regulate gene production by binding to other parts of the DNA. The second picture is of gene regulation and the abstract for its article is Wasserman and Sandelin, "Applied bioinformatics for the identification of regulatory elements," Nature Reviews Genetics, 5 (April 1, 2004): 276-287. You can see there are several elements involved in the regulation, both close and far from the gene (the black line is the DNA). There is often a feed-back system so that when the gene product is available, the chemical interactions lead to repression of further copying of the gene.  When the product decreases, the gene once again is activated. When the mechanism was first discovered, it seemed the transcription factors attached to DNA close to but a little bit apart from the actual gene.  It has been known for a few years that they can attach both to gene and non-gene areas and both near and far from the gene. But now the scientists have discovered an even more surprising situation.

The amazing part that was just announced is that the regulatory protein uses the same type of 3-base-per-codon language used in protein production. So, a protein can come back into the nucleus and combine with the DNA for a regulatory role using a set of 3 codon “letters” for a different function.

Though much more research is needed, it will likely be necessary to understand the interplay of these molecules in order to cure certain diseases.  Over 85% of genes are already shown to have these regulatory codons, and the study has not covered all types of cells.

This discovery is BIG. The research shows that DNA has even more complexity than we imagined, and it greatly limits the possibility that all the functions of DNA simply came about from random molecular mutations. Because of the different language, current evaluations of natural selection are even less convincing than they were before. It shows the regulatory job of DNA is at least as precise as the production of proteins.  As researchers discover more activities for the genes, they find there are fewer changes the sequences can make without wrecking the whole system. That means even less chance for totally materialistic evolution.

Koonin and Collins

Eugene Koonin is a senior investigator at NCBI, the National Center for Biotechnology Information. NCBI is under the National Institutes of Health at Bethesda, MD. Koonin's main research area is genomics. He heads a research group there that has been analyzing genes and comparing them between species.

It is interesting that Francis Collins, (Wikipedia biography HERE and highlighted in my last post), has become the head of the National Institutes of Health (NIH), under which NCBI operates. He was appointed to the post by President Obama in July and confirmed this month. This is the very place that work has been done in disproving Collins' hypothesis of naturalistic, materialist evolution.

Once scientists knew how to evaluate the contents of the gene, as Collins did with humans, researchers worked on various species to determine their specific makeups. The genes are made of molecules which make various patterns. The molecules of DNA are all the same between different species but the patterns are all different. (Pictures of the molecules, called nucleotides, seen at Wikipedia HERE.) There are many species in our world--some estimate 50 million or so. These are subdivided from larger groups, such as animals and plants.

The researchers used organism species from various subgroups to compare genes. Even within bacteria, there are various subgroups and species. Then there is another large group of one-celled organisms called Archaea (are-KEY-ah). These were thought to be relatives of bacteria, but are so different as to now form their own domain. Within Archaea there are subgroups and species also.

The researchers have found amazing results. These are reported in a paper which I have linked with before: Koonin and Wolf, "Genomics of Bacteria and Archaea: the emerging dynamic view of the prokaryotic world," Nucleic Acids Research 36, 21 (Dec. 1, 2008): 6688-6719. All the species are showing unique genes. A proportion of their genes are shared with only one or a few other species. There is no smooth increase from simple to complex, as Darwin predicted.

Some wonder, with so many species in the world and so few (comparatively) checked, whether the others will fill in "gaps." There are several reasons not to expect this. For one, Koonin states in the paper that their selection is across enough diversity that the sample is enough to talk about general principles of genetics.

A second reason is that mathematically, the random motion of molecules and rate of chance switches of DNA molecules within an organism do not jive with the diversity of the findings. The proteins which DNA produces do not match enough between organisms to agree with neo-Darwinism.

The Earth cannot have supported over 10^50 (that's 10 to the 50th power) organisms in the approximately 3.5 billion years of biological life. We know that because of the volume of water on the Earth. That is a limit in which random mutation would have to work to get from one species to another with smooth, small steps predicted in evolution. With the diversity of genes now found, the gap could not be filled with neo-Darwinian, chance changes. The probabilities are just too low.

A third reason to think the gaps will not be filled is that even higher organisms are found to have unique genes. There is reason to believe unique genes will continue to be discovered as more species are sequenced.

I wonder how Francis Collins, who insists on materialistic evolution, will handle the results of the very organization of which he is now in charge. Collins accepts the Anthropic Principle, which in at least one of its versions states the universe is fine-tuned in order for life to exist. Yet we need a Biologic Anthropic Principle to state that the complexity of the cell can only be explained by a supernatural designer and creator. I hope someday Collins realizes this need.

~~~~~~

Yuri Wolf, co-author of the paper mentioned here, is a member of Koonin's research group at NCBI.

2019 Update: Image link to Eugene Koonin.

Nature's Abilities

In my last post I had a picture of Francis Bacon, the originator of our modern scientific method. Now I have another Francis, Dr. Collins, who led the Genome Project which made known the entire makeup of human genes. He is an esteemed scientist and deserves a great deal of credit for making the human genome available to all persons. In contrast, several companies were trying to discover the makeup at the same time and wanted to get commercial patents for it! (This is unimaginable and yet they wanted to own the human genome!)

Dr. Collins also did work on disease related to genes, and made significant contributions in this way. He is a Christian, and has written a book about his conversion called The Language of God. It is hard to go up against what he says, and yet no one is perfect. The Intelligent Design community is at odds with him because he believes that biological life and evolution occurred entirely without direct supervision from God. At the same time he thinks the universe, with its fine-tuning, is the result of God's handiwork. The term for people who believe in evolution with God in the background (to the point of not being allowed to touch it) is "Theistic Evolutionist."

One might ask, why quibble? Well, hopefully these differences are not enough to set Christian upon Christian. But there are a few problems. First, the people like Collins who believe God did not create biology supernaturally end up acting as if it is already proven He didn't. It is not.

Secondly, they teach children as if it is already proven He didn't. That is wrong both morally and in a scientific sense. Science is about evaluating what we know and interpreting it correctly. Morally, they convince children in a dishonest way what they want them to believe instead of telling them the truth.

Third, Theistic Evolutionists deride those who have other ideas. Instead of having both views as possibilities, they exclude the one they don't like. It is all right to have a hypothesis, such as neo-Darwinian materialistic evolution, but unless it is proven, you need to make room for other hypotheses. These people don't. They are disdainful of ID advocates because they fear that ID will destroy incentive to learn more. That is wrong and unfair. Research will continue as long as man has curiosity, which will be always.

It is only fair that ID people should allow for the materialistic view. It is not a matter in this case of what you think is scientifically correct. It is a matter of respect for other people's opinions and beliefs. If educators want to teach children materialistic evolution, they should teach ID right alongside it. Right now, the facts point to, if not already prove, Intelligent Design of biological life and evolution. (To see some of these facts, go through my ID and Creation posts under "Topics at Blog" in the right column.) For believers it would follow that, as it looks now, it is reasonable to think that God supernaturally intervened.

At one discussion about evolution that I attended, a man said he likes to enjoy the creativity of nature. I've seen that sentiment at the BioLogos Foundation website established by Francis Collins. They look at the cell's complexity and imagine nature to have made it. To me, that is like a man who goes away to work during the day, and his wife cleans, buys groceries, does laundry, takes care of the kids. Then she makes a meal that is on the table when the husband returns. He says, "Isn't nature wonderful, that it can put this meal on the table and take care of all the household needs?" Or even, "Honey, I know you somehow had a hand in this, but isn't nature impressive?"

Does God feel unappreciated? Perhaps no more than people whose work is ignored.

Mutations 2

Recently I talked about mutations to genes which cause changes in proteins. The DNA has sets of molecules called nucleotides which pair (therefore also called base pairs). The nucleotides eventually get "read" by biochemical means to produce specific proteins, which do much of the work of the body. I spoke about changes to the genes, one nucleotide at a time, as when it is copied for the next generation. There can also be larger changes to the DNA, as pictured to the right (Wikipedia link HERE), for example gene duplication. However, these changes do not account for the whole story of getting from one protein structure to another. As an analogy, if you duplicate a paragraph in a book, it doesn't increase the information you receive. Intelligent Design proponent Michael Behe vividly describes multiple possible text changes in Herman Melville's Moby Dick, and their potential effects upon the whole story in Michael Behe, The Edge of Evolution, (Free Press, 2008), 116-119. To summarize, there is not much improvement from the original with random changes, as you might imagine.

The base pairs in a gene still have to go through the individual changes in the code so that the new protein/s will be produced.

Mutations 1

On March 14, I gave a talk in Grand Rapids at a conference called "Grand Dialogue." There are several colleges in the area which combine to have this recurring event, the purpose of which is to discuss the relationship between science and religion. I spoke along with Dr. Dennis Marshall of Aquinas college. We had a very attentive group of 12 and we had an interesting discussion afterwards.

The largest problem in discussing ID with a group is that there is so much to cover in so little time. I try to use pictures, but biology and genetics are obviously complex subjects that you can't learn in one afternoon. I assume that people already know certain things, but after the talk I wondered if I assumed too much when talking about mutations. That's why I have this picture here today and will add it to my future presentations.

The letters ATGC represent the molecules that make up the rungs of DNA. They are specific shapes, and are read as a code to make protein in the cell. The protein is made of building blocks called amino acids. The code can have more than one set for a certain amino acid that will be matched to the code, as in the first line where two sets are coding for the same (blue) amino acid. However, when one DNA molecule is changed, for example by a copying mistake, it can change the amino acid and ultimately, eventually, the entire protein can have a new function, or more likely, lose function altogether.

Now, copying mistakes don't come quickly. It can be as little as 1 in 100 million. So in the 3.6 billion base pairs (rungs) of a human, there can be as little as 30 changes in a generation. What is more, many proteins lose their function long before they gain another. When I give my talk, I show some pretty amazing proteins which are thought to have stayed pretty close to way they were in the very first organisms billions of years ago, such as the energy-making machine, ATP synthase. It is true that there may be copying of genes and other changes besides single point DNA change, but if the proteins changed too much, the organism wouldn't even survive to reproduce another generation.

Also, Hubert Yockey found by Information Theory that only one protein in 10^65 has function for a particular job (of a specific short protein with 100 amino acids). It is estimated there can have been no more than 10^50 organisms even on an old earth (Fredric P. Nelson, “Needed: A New Vocabulary for Understanding Evolution,”  Perspectives on Science and Christian Faith 58, 1 (March 2006): 28-36). Therefore, a unique protein (showing up in an organism) coming "from nowhere" and instantly being functional is obviously not from the small changes implied by Darwinian mutation and natural selection.

I hope our audience was able to follow my talk. In any case, they seemed to enjoy it, and I hope they can continue to pursue their interest from this introductory talk and a booklet I provided for them.

FF 6, Bicoid

The protein bicoid is used by the DNA in a fruit fly embryo to determine the proteins that will be made by this same DNA. The concentration of bicoid that is diffusing from front to back of the embryo will be detected by the various genes that make up DNA in nuclei (clumps of DNA) that line the walls from the front to back of the embryo. The link I have given in the previous 2 posts for the fruit fly embryo picture is HERE. I will show the bicoid gene below.

Before I go further, though, I'd like to give you a link to a website that has more reporting on new research that points toward design. It is Evolution News, the newsletter of Discovery Institute (one of the main "think tanks" for Intelligent Design).

The following ATCG letters are the gene code for bicoid in the fruit fly found on the website FlyBase. (Update in 2019: I had a link from FlyBase at the time of the post but it no longer goes there. I do have a link to the code in another database called KEGG. It is HERE.)

ATCTCTTCGCTCATCCCTAAATAACGGCACTCTGCAGATGCGAAGCAGTG
GATCGCAAAAACGCAAAATGTGGGCGAAATAAGTTCGCGAGCGTCTCGAA
AGTAACCGGTTACTGAAAATACAAGAAAGTTTCCACACTCCTTTGCCATT
TTTCCGCGCGGCGCTTGGAAATTCGTAAAGATAACGCGGCGGAGTGTTTG
GGGAAAATGGCGCAACCGCCGCCAGATCAAAACTTTTACCATCATCCGCT
GCCCCACACGCACACACATCCGCATCCGCACTCCCATCCGCATCCGCACT
CGCATCCGCACCCACATCACCAACATCCGCAGCTTCAGTTGCCGCCACAA
TTCCGAAATCCCTTCGATTTGGTGAGTTCCCATCGCAGCAGAGAAGGGCT
CTTGTCCCAGGAAAGCTACAGTACAGATTCCCTATGGTGAACAAACAACC
AGTGCGATCACTGATGACCATAAACATTTATTGAGCCGCAGCAAATGTGT
TTCTAGAACATAGGGCGAAATCTTCTATTATCTTGTTTGTGACTTTTAAA
GTATCGTAGCAGAATCTAAAAACCAATTGATATTATTAATCGTTACAGTT
AGTATAGTATATAATTGTATATGAATTGTGGGGCATCATGTTATTAGTGA
TTTGCCGAAATGTTCTAAAAGGTGTTTCATTGAAATGGACGAATGTTAAA
CCTGTTGCACTCACACCGACAATCAGTAATGTCTATTTTTCAAAAGCCAC
ATCTATGGCCACTGGGTATACATTATTGACTTTATACACTTCATACAACA
TATTTTCTAAAACAAGCATTGTTGTCCTGCATGATGATTAGTGAAAGTAA
TATTGCAAGATTCGGTCCCCGAAGCGAATCGTCCTTTCACGTTTTTATAT
AAAGACAGTGTACCCCTTGATTCTTTGAAGCTTTTCGATGAGCGAACGGG
AGCGATAAACTACAACTACATACGTCCGTATCTGCCCAACCAGATGCCCA
AGCCAGGTGAGCTCAAAGCCAACAAAGTCAGCCATCGTCTTATCAGATGT
CTTTCCCTCAGAGGAGCTGCCCGACTCTCTGGTGATGCGGCGACCACGTC
GCACCCGCACCACTTTTACCAGCTCTCAAATAGCAGAGCTGGAGCAGCAC
TTTCTGCAGGGACGATACCTCACAGCCCCCCGACTTGCGGATCTGTCAGC
GAAACTAGCCCTGGGCACAGCCCAGGTGAAGATATGGTTTAAGAACCGTC
GGCGTCGTCACAAGATCCAATCGGATCAGCACAAGGACCAGTCCTACGAG
GGGATGCCTCTCTCGCCGGGTATGAAACAGAGCGATGGCGATCCCCCCAG
CTTGCAGACTCTTAGCTTGGGTGGAGGAGCCACGCCCAACGCTTTGACTC
CGTCACCCACGCCCTCAACGCCCACTGCACACATGACGGAGCACTACAGC
GAGTCATTCAACGCCTACTACAACTACAATGGAGGCCACAATCACGCCCA
GGCCAATCGTCACATGCACATGCAGTATCCTTCCGGAGGGGGGCCAGGAC
CTGGGTCGACCAATGTCAATGGCGGCCAGTTCTTCCAGCAGCAGCAGGTC
CATAATCACCAGCAGCAACTGCACCACCAGGGCAACCACGTGCCGCACCA
GATGCAGCAGCAGCAACAGCAGGCTCAGCAGCAGCAATACCATCACTTTG
ACTTCCAGCAAAAGCAAGCCAGCGCCTGTCGCGTCCTGGTCAAGGACGAA
CCGGAGGCCGACTACAACTTCAACAGCTCGTACTACATGCGATCGGGAAT
GTCTGGCGCCACTGCATCGGCATCCGCTGTGGCCCGAGGCGCTGCCTCGC
CGGGCTCCGAGGTCTACGAGCCATTAACACCCAAGAATGACGAAAGTCCG
AGTCTGTGTGGCATCGGCATCGGCGGACCTTGCGCCATCGCCGTTGGCGA
GACGGAGGCGGCCGACGACATGGACGACGGAACGAGCAAGAAGACGACGC
TACAGGTCAGGCATGAGTCCACAACCTTTTTTGATCTCTTGATTCTGAGT
GTGGCGTTTATAAATTGAAGCTTTAAGCTTTGTAACTTTCAAACTGTCTG
GTTTGAGATGTTATTCTGAAAGTACTTCTATTTCCGATCGATGAGATTTG
GGAGTTCTCCAATATTTAACATTTAACTTATTAAGTTTTTGTTTTCTAAA
TTAGACATGGCATTTCTGAAAGGGAAGTACAAGTGTTAAAGATGTATTTT
AATATAGAATTTGTATCAAAGGTTAAGATTTCAACCGTTTGAAAGCCCTT
AGTTTTCAGGGTTTTTTACTTTTTTATTCATGTAATCACTCTTAATACAC
TGCAAGTTAAAATAGCATTTCTTTGACCAGAAAAATAAGATCTATGCATT
TTAAAAGTGAAAACAGACTCATATGCTGATGAACATTTTTAGCTATAAAT
TGTAACAATAATTTAGCAATTTCAATCGAATTTATTTATGTTCTAAATGC
GTTCGCTCTCTCCCTAGATCTTGGAGCCTTTGAAGGGTCTGGACAAGAGC
TGCGACGATGGCAGTAGCGACGACATGAGCACCGGAATAAGAGCCTTAGC
AGGAACCGGAAATCGTGGAGCGGCATTTGCCAAATTTGGCAAGCCTTCGC
CCCCACAAGGCCCTCAGCCGCCCCTCGGAATGGGGGGCGTGGCCATGGGC
GAATCGAACCAATATCAATGCACGATGGATACGATAATGCAAGCGTATAA
TCCCCATCGGAACGCCGCGGGCAACTCGCAGTTTGCCTACTGCTTCAATT
AGCCTGGATGAGAGGCGTGTTAGAGAGTTTCATTAGCTTTAGGTTAACCA
CTGTTGTTCCTGATTGTACAAATACCAAGTGATTGTAGATATCTACGCGT
AGAAAGTTAGGTCTAGTCCTAAGATCCGTGTAAATGGTTCCCAGGGAAGT
TTTATGTACTAGCCTAGTCAGCAGGCCGCACGGATTCCAGTGCATATCTT
AGTGATACTCCAGTTAACTCTATACTTTCCCTGCAATACGCTATTCGCCT
TAGATGTATCTGGGTGGCTGCTCCACTAAAGCCCGGGAATATGCAACCAG
TTACATTTGAGGCCATTTGGGCTTAAGCGTATTCCATGGAAAGTTATCGT
CCCACATTTCGGAAATTATATTCCGAGCCAGCAAGAAAATCTTCTCTGTT
ACAATTTGACATAGCTAAAAACTGTACTAATCAAAATGAAAAATGTTTCT
CTTGGGCGTAATCTCATACAATGATTACCCTTAAAGATCGAACATTTAAA
CAATAATATTTGATATGATATTTTCAATTTCTATGCTATGCCAAAGTGTC
TGACATAATCAAACATTTGCGCATTCTTTGACCAAGAATAGTCAGCAAAT
TGTATTTTCAATCAATGCAGACCATTTGTTTCAGATTCGGAGATTTTTTG
CTGCCAAACGGAATAACTATCATAGCTCACATTCTATTTACATCACTAAG
AAGAGCATTGCAATCTGTTAGGCCTCAAGTTTAATTTTAAAATGCTGCAC
CTTTGATGTTGTCTCTTTAAGCTTTGTATTTTTAATTACGAAAATATATA
AGAACTACTCTACTCGGGT

Each of these letter stands for what is called a nucleotide, which is made up of atoms. A picture of one of them, thymine (T) is here:

The atoms are C for carbon, O for oxygen, H for hydrogen and N for nitrogen. You would have to substitute one of these nucleotides for each of the letters of bicoid gene that is above to give one strand of the DNA. This alone does not present the whole picture of complexity, because the DNA of the embryo has parts which detect the concentrations of bicoid that the mother's cells stimulate into production inside the new embryo which in turn set the embryo bicoid gene into motion. Some embryo DNA genes are sensitive to high concentrations of bicoid, some are sensitive to less concentrations.

The fruit fly has 180 million pairs of nucleotides. Half of a nucleotide pair is shown in the picture. The organism uses these nucleotides as a blueprint to make all the body parts like head, eyes, legs, thorax, and systems of its body, including muscle, nerve, breathing, circulatory, hormonal, digestive and reproductive systems.

The human being has 3.6 billion of these nucleotide pairs in one set of Chromosomes. John Lennox goes through some of the probabilities for the atoms and molecules to come to these structures by chance in his book, God's Undertaker: Has Science Buried God? (Oxford: Lion, 2007). He teaches math at Oxford University. It comes down to being impossible. He suggests we look at life like we have come to understand perpetual motion machines--that it just doesn't happen by the laws of nature.
 
Combine that with the findings of the article, Koonin and Wolf, "Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world," Nucleic Acids Research 36, 21 (1 Dec. 2008): 6688-6719l. Eugene Koonin and Yuri Wolf are researchers at the National Center for Biotechnology Information (NCBI). The proteins of bacteria are unlike those of other animals and plants. There is not a smooth line of evolution and there is not enough time for all these proteins to have come into working order even in billions of years. Yes, there may be small changes to bring about some variety in species. But for the most part, something else must be involved.

I am not an expert at reading gene graphs and knowing all the in's and out's of genes. I'm not an expert mathematician or chemist or physicist. Which one person is all of these put together? I know enough to know organisms did not come about by chance. That is because it is obvious. To paraphrase Paul in Romans 1 of the Bible, we can see the magnificent divine nature of God from what is made. These days, because of all that is known, one can look more closely and dig deeper, but the phenomenal majesty of the world still is there to see.